Up to 50% of cases of colorectal cancer contain K-ras gene mutations (Capellá et al, 1991). Several studies showed that it is possible to detect K-ras mutations in the DNA from colonic cancer cells exfoliated in the stool (Sidransky et al,1992; Smith-Ravin et al, 1995). The development of high sensitivity techniques has opened the possibility of analyzing samples that contain a low proportion of tumor cells such as fecal samples. One of these techniques, the intermediate digestion enriched RFLP-PCR (IDE) (Khan et al, 1991; Mora et al, 1998), may detect up to 1 mutant allele among 10⁴-10⁵ normal alleles. Recently, a novel enriched one step PCR strategy to detect K-ras mutations in codon 12, known as restriction endonuclease-mediated selective PCR (REMS-PCR), has been described (Ward et al, 1998). This method is based on the thermostability of the BstNI enzyme. We report a new highly sensitive technique that combines a two step RFLP/PCR and its continuous enrichment for the mutant allele by enzymatic digestion during the first PCR on the basis of the known thermostability of the BstNI enzyme.

This two step PCR method simplifies the intermediate digestion technique described by Kahn et al (1991). In CED-RFLP/PCR, 0.75-1.5uL of each sample or control was added to a 50 uL reaction mixture containing PCR buffer (50 mmol/L KCl, 20 mmol/L Tris HCl [pH 8.4]), 1.5 muL MgCl₂, 0.2 mmol/L dNTPs (Promega, Madison, Wisconsin), 0.1 umol/L of K5': 5'ACTGAATATAAACTTGT-GGTAGTTGGAC*CT 3' (Jiang et al, 1989) and the wild-type primer DD5P 5'TCATGAAAATGGTCAGAGAA 3' (Mora et al, 1998), 1 U of Taq DNA polymerase (GIBCO/BRL, Gaithersburg, Maryland) and 10 units of BstNI (New England Biolabs, Beverly, Massachusetts). CED-RFLP/PCR yielded a PCR product in 33 of the 37 fecal samples analyzed (89%). In contrast, amplification was possible in 29 cases (78%) with a nonenriched (NE) method (Mora et al, 1998) and in 27 cases with the IDE technique (73%). The higher PCR yield obtained with the new method, even better than the NE yield, could be attributed to a putative better access to target DNA sequences by Taq polymerase after enzymatic digestion of genomic DNA by the added enzyme that can cut in many sites because of its recognition sequence (5' CCA/TGG 3'). The first step of PCR was carried out for 12 cycles (54šC for 15 seconds, 72šC for 15 seconds, and 90šC for 15 seconds) in a Hybaid Omnigene PCR system. The number of cycles of the first-round PCR has been a critical step in adjusting the CED-RFLP/PCR; in our experimental conditions, when 12 to 14 cycles were used and equimolar primer concentration was added, the appearance of spurious bands of the same size of the mutant allele was avoided. Our final approach of a 12-cycle first-round PCR is a conservative one that partially sacrifices sensitivity to attain a better reproducibility and diminish the risk of DNA contamination. The upstream primer, K5' (Jiang et al, 1989), artificially creates a new BstNI restriction site (5' C*CTGG 3') that is lost when a K-ras codon 12 mutation exists. The addition of BstNI and this new restriction site are responsible for the continuous digestion of the nonmutated PCR products in early PCR cycles of CED-RFLP/PCR method, disabling them as templates for the next PCR cycle, a situation that results in an improved sensitivity in the detection of the mutant allele (Fig. 1). A volume of 1.5 |gmL of the first PCR product was reamplified using essentially the same conditions described above in the presence of 0.5 |gmmol/L of the same upstream primer, K5', and the downstream primer K3' 5' TCAAAGAATGGTCCTGG*ACC 3' (Jiang et al, 1989). The K3' primer incorporates another BstNI restriction site (5' C*CAGG 3') that serves as an internal control for completion of enzymatic digestion. For the second PCR, the optimal number of cycles was set to 35-40 cycles. In this reaction BstNI was not added to the reaction mix. Internal controls are key issues in the interpretation of these highly sensitive assays. In our method, the addition of the internal control for enzymatic digestion excludes partial digestion. The second-round heminested PCR without the restriction enzyme allows the amplification of the normal alleles that did not incorporate the restriction site in the first-round PCR. This apparent limitation of the assay offers the best internal control for amplification. Twenty microliters of the second amplification products were incubated for 2 hours at 60šC with 5 units of the BstNI restriction enzyme (New England Biolabs) in a final volume of 30 uL. The digested products were run on an 8% polyacrylamide gel and stained with ethidium bromide. The new method is able to detect mutations in 12 of 33 fecal samples obtained from colorectal tumor patients (36%), whereas the NE and the IDE detected 6 of 29 (21%) and 8 of 27 (30%), respectively. None of the techniques detected mutations in the presence of benign diseases (0 of 24).

In summary, analytical sensitivity, practicability, and PCR yield are enhanced by this two step process offering a quick, easy, robust, and nonradioactive detection of one K-ras mutant allele in 105 normal copies, improving the amplification yield and the capability of detecting codon 12 K-ras mutations of the NE and IDE techniques in fecal samples.


References

Capellá G, Cronauer-Mitra S, Peinado MA, and Perucho M (1991). Frequency and spectrum of mutations at codons 12 and 13 of the K-ras gene in human tumors. Environ Health Perspect 93:125-131.

Jiang W, Khan SM, Guillem JG, Lu S-H, and Weinstein IB (1989). Rapid detection of ras oncogenes in human tumors: Applications to colon, esophageal, and gastric cancer. Oncogene 4:923-928.

Khan SM, Jiang W, Culbertson TA, Weinstein IB, Williams GM, Tomita N, and Ronai Z (1991). Rapid and sensitive nonradioactive detection of mutant K-ras genes via enriched PCR amplification. Oncogene 6:1079-1083.

Mora J, Puig P, Boadas J, Urgell E, Montserrat E, Lerma E, González-Sastre F, Lluís F, Farré A, and Capellá G (1998). K-ras gene mutations in the diagnosis of fine-needle aspirates of pancreatic masses: Prospective study using two techniques with different detection limits. Clin Chem 44:2243-2248.

Sidransky D, Tokino T, Hamilton SR, Kinzler KW, Levin B, Frost P, and Vogelstein B (1992). Identification of ras oncogene mutation in the stool of patients with curable colorectal tumors. Science 256:102-105.

Smith-Ravin J, England J, Talbot IC, and Bodmer W (1995). Detection of c-Ki-ras mutations in faecal samples from sporadic colorectal cancer patients. Gut 36:81-86.

Ward R, Hawkins N, O'Grady R, Sheehan C, O'Connor T, Impey H, Roberts N, Fuery C, and Todd A (1998). Restriction endonuclease-mediated selective polymerase chain reaction. A novel assay for the detection of K-ras mutations in clinical samples. Am J Pathol 153:373-379